After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GART Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AK168445.1
Размер кДНК:1302bp
Описание кДНК:Full length Clone DNA of Mus musculus phosphoribosylglycinamide formyltransferase with C terminal His tag.
Синоним гена:Gaps, Prgs
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52285-ACGRBS15400
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52285-ACRRBS15396
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52285-ANGRBS15396
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52285-ANRRBS15396
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52285-CFRBS13340
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52285-CHRBS13340
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52285-CMRBS13343
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52285-CYRBS13340
Мышь GART/Glycinamide ribonucleotide transformylase Джин клон кДНК в вектор клонированияMG52285-GRBS5130
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52285-NFRBS13340
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52285-NHRBS13340
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52285-NMRBS13340
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52285-NYRBS13340
Мышь GART/Glycinamide ribonucleotide transformylase Джин ORF экспрессии кДНК клона плазмидыMG52285-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52285-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».