After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GAPDH Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008084.2
Размер кДНК:1002bp
Описание кДНК:Full length Clone DNA of Mus musculus glyceraldehyde-3-phosphate dehydrogenase with N terminal HA tag.
Синоним гена:Gapd, MGC102544, MGC102546, MGC103190, MGC103191, MGC105239, Gapdh
Виды:Mouse
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50545-ACGRBS15400
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50545-ACRRBS15400
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50545-ANGRBS15400
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50545-ANRRBS15400
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50545-CFRBS13340
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50545-CHRBS13340
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50545-CMRBS13340
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50545-CYRBS13340
Мышь GAPDH Джин клон кДНК в вектор клонированияMG50545-MRBS5130
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50545-NFRBS13340
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50545-NHRBS13340
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50545-NMRBS13340
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50545-NYRBS13340
Мышь GAPDH Джин ORF экспрессии кДНК клона плазмидыMG50545-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.

Ссылки
  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.
  • Size / Price
    Каталог: MG50545-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».