After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GALNT18 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AB175685.1
Размер кДНК:1824bp
Описание кДНК:Full length Clone DNA of Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18 with N terminal Myc tag.
Синоним гена:Galntl4, BC024988, 2900011G21Rik
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51455-ACGRBS16760
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51455-ACRRBS16760
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51455-CFRBS14710
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51455-CHRBS14710
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51455-CMRBS14710
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51455-CYRBS14710
Мышь GALNT18 Джин клон кДНК в вектор клонированияMG51455-GRBS5130
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51455-NFRBS14710
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51455-NHRBS14710
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51455-NMRBS14710
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51455-NYRBS14710
Мышь GALNT18 Джин ORF экспрессии кДНК клона плазмидыMG51455-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51455-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».