Быстрый заказ

Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь GALE Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_178389.3
    Размер кДНК:1044bp
    Описание кДНК:Full length Clone DNA of Mus musculus galactose-4-epimerase, UDP with C terminal HA tag.
    Синоним гена:AI323962, 2310002A12Rik
    Виды:Mouse
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GALE qPCR primers for gene expression analysis, MP201643 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51770-ACGRBS15400
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51770-ACRRBS15400
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51770-ANGRBS15400
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51770-ANRRBS15400
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51770-CFRBS13340
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51770-CHRBS13340
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51770-CMRBS13340
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51770-CYRBS13340
    Мышь UDP galactose-4'-epimerase / GALE Джин клон кДНК в вектор клонированияMG51770-GRBS5130
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51770-NFRBS13340
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51770-NHRBS13340
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51770-NMRBS13340
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51770-NYRBS13340
    Мышь UDP galactose-4'-epimerase / GALE Джин ORF экспрессии кДНК клона плазмидыMG51770-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    UDP galactose-4'-epimerase, also known as GALE, enables the body to process a simple sugar called galactose, which is present in small amounts in many foods. Galactose is primarily part of a larger sugar called lactose, which is found in all dairy products and many baby formulas. UDP galactose-4'-epimerase catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. Defects in GALE causes epimerase-deficiency galactosemia (EDG), also known as galactosemia type 3. Clinical features include early-onset cataracts, liver damage, deafness and mental retardation.

    Ссылки
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Lee KA. et al., 2011,. J Biol Chem. 286 (48): 41530-8.
  • McCorvie TJ. et al., 2012, Biochim Biophys Acta. 1822 (10): 1516-26.
  • Size / Price
    Каталог: MG51770-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».