Быстрый заказ

Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь FZD4 Информация о продукте «Клон cDNA»
Размер кДНК:1614bp
Описание кДНК:Full length Clone DNA of Mus musculus frizzled homolog 4 (Drosophila) with C terminal Myc tag.
Синоним гена:Fz4, Fzd4
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
( We provide with FZD4 qPCR primers for gene expression analysis, MP200399 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50379-ACGRBS16760
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50379-ACRRBS16760
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50379-CFRBS14710
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50379-CHRBS14710
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50379-CMRBS14710
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50379-CYRBS14710
Мышь Frizzled-4/FZD4/CD344 Джин клон кДНК в вектор клонированияMG50379-MRBS5130
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50379-NFRBS14710
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50379-NHRBS14710
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50379-NMRBS14710
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50379-NYRBS14710
Мышь Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмидыMG50379-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50379-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.