After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FTSJ3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025310.2
Размер кДНК:2517bp
Описание кДНК:Full length Clone DNA of Mus musculus FtsJ homolog 3 (E. coli) with N terminal Myc tag.
Синоним гена:Epcs3, C79843, AA537063, AU045295, D11Ertd400e
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52589-ACGRBS22240
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52589-ACRRBS22240
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52589-ANGRBS22240
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52589-ANRRBS22240
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52589-CFRBS20190
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52589-CHRBS20190
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52589-CMRBS20190
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52589-CYRBS20190
Мышь FTSJ3 Джин клон кДНК в вектор клонированияMG52589-GRBS5130
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52589-NFRBS20190
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52589-NHRBS20190
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52589-NMRBS20190
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52589-NYRBS20190
Мышь FTSJ3 Джин ORF экспрессии кДНК клона плазмидыMG52589-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52589-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».