FRG1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52322-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FRG1 Reagents

CRO Services

Product recommended


All FRG1 Reagents

FRG1 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
777 bp
Description
Full length Clone DNA of Mouse FSHD region gene 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FRG1 Background Information

Full Name
FSHD region gene 1

FRG1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FRG1 cDNA ORF Clone in Cloning Vector, Mouse MG52322-G
FRG1 cDNA ORF Clone, Mouse, untagged MG52322-UT
FRG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52322-ACG
FRG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52322-ACGLN
FRG1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52322-ANG
FRG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52322-ACR
FRG1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52322-ANR
FRG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52322-CF
FRG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52322-NF
FRG1 cDNA ORF Clone, Mouse, C-His tag MG52322-CH
FRG1 cDNA ORF Clone, Mouse, N-His tag MG52322-NH
FRG1 cDNA ORF Clone, Mouse, C-HA tag MG52322-CY
FRG1 cDNA ORF Clone, Mouse, N-HA tag MG52322-NY
FRG1 cDNA ORF Clone, Mouse, C-Myc tag MG52322-CM
FRG1 qPCR Primer Pairs, Mouse MP202195

FRG1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FRG1 cDNA ORF Clone in Cloning Vector, Human HG15246-G
FRG1 cDNA ORF Clone, Human, untagged HG15246-UT
FRG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15246-ACGLN
FRG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15246-ACG
FRG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15246-ANG
FRG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15246-ACR
FRG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15246-ANR
FRG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15246-CF
FRG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15246-NF
FRG1 cDNA ORF Clone, Human, C-His tag HG15246-CH
FRG1 cDNA ORF Clone, Human, N-His tag HG15246-NH
FRG1 cDNA ORF Clone, Human, C-HA tag HG15246-CY
FRG1 cDNA ORF Clone, Human, N-HA tag HG15246-NY
FRG1 cDNA ORF Clone, Human, C-Myc tag HG15246-CM
FRG1 cDNA ORF Clone, Human, N-Myc tag HG15246-NM
FRG1 qPCR Primer Pairs, Human HP103872
info info
添加购物车成功! 添加购物车失败!