FNDC4 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51357-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FNDC4 Reagents

CRO Services

Product recommended


All FNDC4 Reagents

FNDC4 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
696 bp
Description
Full length Clone DNA of Mouse fibronectin type III domain containing 4 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FNDC4 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

2810430J06Rik cDNA ORF Clone, Mouse;6330410H20Rik cDNA ORF Clone, Mouse;AB030187 cDNA ORF Clone, Mouse;AI838506 cDNA ORF Clone, Mouse;AW487863 cDNA ORF Clone, Mouse;Fnmp1 cDNA ORF Clone, Mouse;FRCP1 cDNA ORF Clone, Mouse

FNDC4 Background Information

Full Name
fibronectin type III domain containing 4

FNDC4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FNDC4 cDNA ORF Clone in Cloning Vector, Mouse MG51357-U
FNDC4 cDNA ORF Clone, Mouse, untagged MG51357-UT
FNDC4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51357-ACGLN
FNDC4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51357-ACG
FNDC4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51357-ACR
FNDC4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51357-CF
FNDC4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51357-NF
FNDC4 cDNA ORF Clone, Mouse, C-His tag MG51357-CH
FNDC4 cDNA ORF Clone, Mouse, N-His tag MG51357-NH
FNDC4 cDNA ORF Clone, Mouse, C-HA tag MG51357-CY
FNDC4 cDNA ORF Clone, Mouse, N-HA tag MG51357-NY
FNDC4 cDNA ORF Clone, Mouse, N-Myc tag MG51357-NM
FNDC4 qPCR Primer Pairs, Mouse MP201234

FNDC4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FNDC4 cDNA ORF Clone in Cloning Vector, Human HG15459-G
FNDC4 cDNA ORF Clone, Human, untagged HG15459-UT
FNDC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG15459-ACG
FNDC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15459-ACGLN
FNDC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG15459-ACR
FNDC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15459-CF
FNDC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15459-NF
FNDC4 cDNA ORF Clone, Human, C-His tag HG15459-CH
FNDC4 cDNA ORF Clone, Human, N-His tag HG15459-NH
FNDC4 cDNA ORF Clone, Human, C-HA tag HG15459-CY
FNDC4 cDNA ORF Clone, Human, N-HA tag HG15459-NY
FNDC4 cDNA ORF Clone, Human, C-Myc tag HG15459-CM
FNDC4 cDNA ORF Clone, Human, N-Myc tag HG15459-NM
FNDC4 qPCR Primer Pairs, Human HP104083
info info
添加购物车成功! 添加购物车失败!