Быстрый заказ

Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь FNDC4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022424.5
Размер кДНК:696bp
Описание кДНК:Full length Clone DNA of Mus musculus fibronectin type III domain containing 4.
Синоним гена:FRCP1, Fnmp1, AB030187, AI838506, AW487863, 2810430J06Rik, 6330410H20Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FNDC4 qPCR primers for gene expression analysis, MP201234 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51357-ACGRBS15400
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51357-ACRRBS15400
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51357-CFRBS13340
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51357-CHRBS13340
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51357-CMRBS13340
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51357-CYRBS13340
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51357-NFRBS13340
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51357-NHRBS13340
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51357-NMRBS13340
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51357-NYRBS13340
Мышь FNDC4/FRCP1 Джин клон кДНК в вектор клонированияMG51357-URBS5130
Мышь FNDC4/FRCP1 Джин ORF экспрессии кДНК клона плазмидыMG51357-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51357-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».