After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FLT3LG Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013520.3
Размер кДНК:699bp
Описание кДНК:Full length Clone DNA of Mus musculus FMS-like tyrosine kinase 3 ligand with C terminal HA tag.
Синоним гена:Ly72L, Flt3lg
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:pCMV3-mFLT3LG-HA
Участок рестрикции:KpnI + XbaI (6kb + 0.74kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FLT3LG Gene Plasmid Map
Mouse FLT3L natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51113-ACGRBS15400
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51113-ACRRBS15400
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51113-CFRBS13340
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51113-CHRBS13340
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51113-CMRBS13340
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51113-CYRBS13340
Мышь FLT3L / Flt3 ligand Джин клон кДНК в вектор клонированияMG51113-GRBS5130
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51113-NFRBS13340
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51113-NHRBS13340
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51113-NMRBS13340
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51113-NYRBS13340
Мышь FLT3L / Flt3 ligand Джин ORF экспрессии кДНК клона плазмидыMG51113-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

FLT3L, also known as flt3 ligand, is a small molecule that acts as a growth factor that increases the number of immune cells by activating the hematopoietic progenitors. In vivo, FLT3L also induces the mobilization of the hematopoietic progenitors and stem cells. This may help the system to kill cancer cells. Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3L controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 -positive classical DCs and their CD103 -positive tissue counterparts.

Ссылки
  • Hannum C, et al. (1994) Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem cells and is encoded by variant RNAs. Nature 368 (6472): 643-8.
  • Lyman SD, et al. (1995) Identification of soluble and membrane-bound isoforms of the murine flt3 ligand generated by alternative splicing of mRNAs. Oncogene 10 (1): 149-57.
  • Lyman SD, et al. (1994) Molecular cloning of a ligand for the flt3/flk-2 tyrosine kinase receptor: a proliferative factor for primitive hematopoietic cells. Cell 75 (6): 1157-67.
  • Size / Price
    Каталог: MG51113-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse FLT3L natural ORF mammalian expression plasmid, C-HA tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».