After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FLRT2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_201518.4
Размер кДНК:1983bp
Описание кДНК:Full length Clone DNA of Mus musculus fibronectin leucine rich transmembrane protein 2 with C terminal His tag.
Синоним гена:KIAA0405, Flrt2
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51074-ACGRBS16764
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51074-ACRRBS16764
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51074-CFRBS14711
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51074-CHRBS14711
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51074-CMRBS14711
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51074-CYRBS14711
Мышь FLRT2 Джин клон кДНК в вектор клонированияMG51074-GRBS5132
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51074-NFRBS14711
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51074-NHRBS14711
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51074-NMRBS14711
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51074-NYRBS14711
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмидыMG51074-UTRBS14711
Мышь FLRT2 Джин ORF экспрессии кДНК клона плазмидыMG51074-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Fibronectin Leucine-Rich Transmembrane (FLRT) proteins are glycosylated membrane proteins expressed at the cell surface which localise in a homophilic manner to cell-cell contacts expressing the focal adhesion marker vinculin. FLRT1, FLRT2, and FLRT3, the three genes encode putative type I transmembrane proteins, each containing 10 leucine-rich repeats (LRR), a type III fibronectin (FN) domain, followed by the transmembrane region, and a short cytoplasmic tail. FLRT family members may function in cell adhesion and/or receptor signalling. Each member of the FLRT family has a distinct, highly regulated expression pattern, as was seen for the NLRR family. FLRT2 is expressed in a subset of the sclerotome, adjacent to the region that forms the syndetome, suggesting that interaction with FGF signalling may be a general property of FLRT proteins. All FLRTs can interact with FGFR1 and FLRTs can be induced by the activation of FGF signalling by FGF-2. FLRT proteins have a dual role, promoting FGF signalling and modulating homotypic cell adhesion. FLRT2 played critical roles in craniofacial development, and it was also present in the vomero-nasal organ, mandibular primodia, and the posterior aspects of the unfused and fused secondary palatal shelves.

Ссылки
  • Lacy SE, et al. (1999) Identification of FLRT1, FLRT2, and FLRT3: a novel family of transmembrane leucine-rich repeat proteins. Genomics. 62(3): 417-26.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Karaulanov EE, et al. (2006) A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion. EMBO Rep. 7(3): 283-90.
  • Maretto S, et al. (2008) Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich transmembrane protein FLRT3. Dev Biol. 318(1): 184-93.
  • Gong SG, et al. (2009) Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development. Gene Expr Patterns. 9(7): 497-502.
  • Size / Price
    Каталог: MG51074-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».