Быстрый заказ

Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FKBP4 Информация о продукте «Клон cDNA»
Размер кДНК:1377bp
Описание кДНК:Full length Clone DNA of Mus musculus FK506 binding protein 4 with N terminal Flag tag.
Синоним гена:p59, 59kDa, FKBP-4, FKBP52, FKPB52, FKBP-52, AL022792, AW208983
Участок рестрикции:KpnI + NotI (6kb + 1.42kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FKBP4 Gene Plasmid Map
Mouse FKBP4 ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52922-ACGRBS15400
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52922-ACRRBS15400
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52922-ANGRBS15400
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52922-ANRRBS15400
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52922-CFRBS13340
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52922-CHRBS13340
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52922-CMRBS13340
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52922-CYRBS13340
Мышь FKBP52/FKBP4 Джин клон кДНК в вектор клонированияMG52922-GRBS5130
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52922-NFRBS13340
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52922-NHRBS13340
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52922-NMRBS13340
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52922-NYRBS13340
Мышь FKBP52/FKBP4 Джин ORF экспрессии кДНК клона плазмидыMG52922-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52922-NF
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Mouse FKBP4 ORF mammalian expression plasmid, N-Flag tag
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.