After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FKBP1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008019.2
Размер кДНК:327bp
Описание кДНК:Full length Clone DNA of Mus musculus FK506 binding protein 1a.
Синоним гена:Fkbp, 12kDa, Fkbp1, FKBP12, mFKBP1, mFKBP12, FKBP12-T1, FKBP12-T2, Fkbp1a
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:pCMV3-mFKBP1A
Участок рестрикции:KpnI + XbaI (6.1kb + 0.33kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FKBP1A Gene Plasmid Map
Mouse FKBP1A / FKBP12 natural ORF mammalian expression plasmid
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50265-ACGRBS15396
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50265-ACRRBS15400
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50265-ANGRBS15396
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50265-ANRRBS15400
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50265-CFRBS13340
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50265-CHRBS13340
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50265-CMRBS13343
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50265-CYRBS13340
Мышь FKBP12/FKBP1A Джин клон кДНК в вектор клонированияMG50265-MRBS5130
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50265-NFRBS13340
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50265-NHRBS13340
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50265-NMRBS13343
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50265-NYRBS13340
Мышь FKBP12/FKBP1A Джин ORF экспрессии кДНК клона плазмидыMG50265-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

FK506 binding protein 12 (FKBP12), also known as FKBP1, along with cyclophilin, are two major members of the immunophilin protein family who serve as receptors for the immunosuppressant drugs cyclosporin A and FK506. As a conserved molecules in many eukaryotes, FKBP12 has been characterized as a peptidyl-prolyl isomerase that catalyzes the transition between cis- and trans-proline residues, and is involved in several biochemical processes including protein folding, receptor signaling, protein trafficking and transcription. FKBP12 has attracted immense attention and its role in mediating the immunosuppressive functions. FKBP12 serves a dual role as a peptidyl-prolyl cis-trans isomerase and as a modulator of several cell signaling pathways. In one such a role, FKBP12 interacts with and regulates the functional state of the ryanodine Ca2+ channel receptor by altering protein conformation and coordinating multi-protein complex formation. Another physiological role of FKBP12 is an interactor and a regulator of the type I serine/threonine kinase receptors of TGF-beta superfamily. Current data, derived from detailed biochemical studies as well as from functional studies in various systems, suggest that FKBP12 functions as a "guardian" for the type I receptors to prevent them from leaky signaling under sub-optimal ligand concentrations, thereby providing a molecular "gradient reader" for TGF-beta family morphogens. This aspect of FKBP12 function may be critical for cellular responsiveness to morphogenetic gradients of the TGF-beta family members during early development, serving to assure the translation of different ligand concentrations into different signaling readouts. In addition, FKBP12 may be involved in neuronal or astrocytic cytoskeletal organization and in the abnormal metabolism of tau protein in Alzheimer's disease (AD) damaged neurons.

Ссылки
  • Wang T, et al. (2004) The immunophilin FKBP12: a molecular guardian of the TGF-beta family type I receptors. Front Biosci. 9: 619-31.
  • Sugata H, et al. (2009) A peptidyl-prolyl isomerase, FKBP12, accumulates in Alzheimer neurofibrillary tangles. Neurosci Lett. 459(2): 96-9.
  • Brath U, et al. (2009) Differential responses of the backbone and side-chain conformational dynamics in FKBP12 upon binding the transition-state analog FK506: implications for transition-state stabilization and target protein recognition. J Mol Biol. 387(1): 233-44.
  • Scaramello CB, et al.. (2009) FKBP12 depletion leads to loss of sarcoplasmic reticulum Ca(2+) stores in rat vas deferens. J Pharmacol Sci. 109(2): 185-92.
  • Size / Price
    Каталог: MG50265-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse FKBP1A / FKBP12 natural ORF mammalian expression plasmid
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».