After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FGFR4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008011.2
Размер кДНК:2400bp
Описание кДНК:Full length Clone DNA of Mus musculus fibroblast growth factor receptor 4 with N terminal Myc tag.
Синоним гена:Fgfr-4, Fgfr4
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50194-ACGRBS16760
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50194-ACRRBS16760
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50194-CFRBS14710
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50194-CHRBS14710
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50194-CMRBS14710
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50194-CYRBS14710
Мышь FGFR4/CD334 Джин клон кДНК в вектор клонированияMG50194-MRBS5130
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50194-NFRBS14710
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50194-NHRBS14710
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50194-NMRBS14710
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50194-NYRBS14710
Мышь FGFR4/CD334 Джин ORF экспрессии кДНК клона плазмидыMG50194-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Fibroblast growth factor receptor 4 (FGFR4) also known as CD334 antigen or tyrosine kinase related to fibroblast growth factor receptor, is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR4/CD334 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. FGFR4/CD334 preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. FGFR4/CD334 signaling is down-regulated by receptor internalization and degradation; MMP14 promotes internalization and degradation of FGFR4/CD334. Mutations in FGFR4/CD334 lead to constitutive kinase activation or impair normal FGFR4 inactivation lead to aberrant signaling.

Ссылки
  • Hart KC, et al. (2000) Transformation and Stat activation by derivatives of FGFR1, FGFR3, and FGFR4. Oncogene. 19(29): 3309-20.
  • Xie MH, et al. (1999) FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4. Cytokine. 11(10): 729-35.
  • Yu C, et al. (2000) Elevated cholesterol metabolism and bile acid synthesis in mice lacking membrane tyrosine kinase receptor FGFR4. J Biol Chem. 275(20): 15482-9.
  • Size / Price
    Каталог: MG50194-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».