Быстрый заказ

Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FGFBP1 Информация о продукте «Клон cDNA»
Размер кДНК:756bp
Описание кДНК:Full length Clone DNA of Mus musculus fibroblast growth factor binding protein 1 with C terminal His tag.
Синоним гена:FGF-BP, Fgfbp1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50449-ACGRBS15396
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50449-ACRRBS15396
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50449-CFRBS13343
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50449-CHRBS13343
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50449-CMRBS13343
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50449-CYRBS13343
Мышь FGFBP1 Джин клон кДНК в вектор клонированияMG50449-MRBS5132
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50449-NFRBS13343
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50449-NHRBS13343
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50449-NMRBS13343
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50449-NYRBS13343
Мышь FGFBP1 Джин ORF экспрессии кДНК клона плазмидыMG50449-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50449-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.