FGF10 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

FGF10 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
609 bp
Description
Full length Clone DNA of Mouse fibroblast growth factor 10 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FGF10 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

AEY17 cDNA ORF Clone, Mouse; BB213776 cDNA ORF Clone, Mouse; Fgf-10 cDNA ORF Clone, Mouse; Gsfaey17 cDNA ORF Clone, Mouse

FGF10 Background Information

Fibroblast growth factor 1 (FGF1) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF1 exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. FGF1 plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. FGF1 is required for normal branching morphogenesis. It may play a role in wound healing. Defects in FGF1 are the cause of autosomal dominant aplasia of lacrimal and salivary glands (ALSG). ALSG has variable expressivity, and affected individuals may have aplasia or hypoplasia of the lacrimal, parotid, submandibular and sublingual glands and absence of the lacrimal puncta. The disorder is characterized by irritable eyes, recurrent eye infections, epiphora (constant tearing) and xerostomia (dryness of the mouth), which increases the risk of dental erosion, dental caries, periodontal disease and oral infections.
Full Name
fibroblast growth factor 10
References
  • Sekine K, et al. (1999) Fgf10 is essential for limb and lung formation. Nat Genet. 21(1): 138-41.
  • Ohuchi H, et al. (2000) FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse multi-organ development. Biochem Biophys Res Commun. 277(3): 643-9.
  • Bellusci S, et al. (1997) Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development. 124(23): 4867-78.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait