After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FGF10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008002.3
Размер кДНК:609bp
Описание кДНК:Full length Clone DNA of Mus musculus fibroblast growth factor 10 with N terminal Myc tag.
Синоним гена:FGF-10, BB213776, Fgf10
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50196-ACGRBS15400
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50196-ACRRBS15400
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50196-CFRBS13340
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50196-CHRBS13340
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50196-CMRBS13340
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50196-CYRBS13340
Мышь FGF10 / KGF2 Джин клон кДНК в вектор клонированияMG50196-MRBS5130
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50196-NFRBS13340
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50196-NHRBS13340
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50196-NMRBS13340
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50196-NYRBS13340
Мышь FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмидыMG50196-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Fibroblast growth factor 10 (FGF10) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF10 exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. FGF10 plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. FGF10 is required for normal branching morphogenesis. It may play a role in wound healing. Defects in FGF10 are the cause of autosomal dominant aplasia of lacrimal and salivary glands (ALSG). ALSG has variable expressivity, and affected individuals may have aplasia or hypoplasia of the lacrimal, parotid, submandibular and sublingual glands and absence of the lacrimal puncta. The disorder is characterized by irritable eyes, recurrent eye infections, epiphora (constant tearing) and xerostomia (dryness of the mouth), which increases the risk of dental erosion, dental caries, periodontal disease and oral infections.

Ссылки
  • Sekine K, et al. (1999) Fgf10 is essential for limb and lung formation. Nat Genet. 21(1): 138-41.
  • Ohuchi H, et al. (2000) FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse multi-organ development. Biochem Biophys Res Commun. 277(3): 643-9.
  • Bellusci S, et al. (1997) Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development. 124(23): 4867-78.
  • Size / Price
    Каталог: MG50196-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».