Быстрый заказ

Text Size:AAA

Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FBXW2 Информация о продукте «Клон cDNA»
Размер кДНК:978bp
Описание кДНК:Full length Clone DNA of Mus musculus F-box and WD-40 domain protein 2 with C terminal His tag.
Синоним гена:MD6, FBW2, Fwd2, 2700071L08Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52276-ACGRBS15396
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52276-ACRRBS15396
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52276-ANGRBS15396
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52276-ANRRBS15396
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52276-CFRBS13343
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52276-CHRBS13343
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52276-CMRBS13343
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52276-CYRBS13343
Мышь FBXW2 Джин клон кДНК в вектор клонированияMG52276-GRBS5132
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52276-NFRBS13343
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52276-NHRBS13343
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52276-NMRBS13343
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52276-NYRBS13343
Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмидыMG52276-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52276-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.