Быстрый заказ

Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь FBXW2 Информация о продукте «Клон cDNA»
    Размер кДНК:978bp
    Описание кДНК:Full length Clone DNA of Mus musculus F-box and WD-40 domain protein 2 with C terminal His tag.
    Синоним гена:MD6, FBW2, Fwd2, 2700071L08Rik
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with FBXW2 qPCR primers for gene expression analysis, MP202149 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52276-ACGRBS15400
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52276-ACRRBS15400
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52276-ANGRBS15400
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52276-ANRRBS15400
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52276-CFRBS13340
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52276-CHRBS13340
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52276-CMRBS13340
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52276-CYRBS13340
    Мышь FBXW2 Джин клон кДНК в вектор клонированияMG52276-GRBS5130
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52276-NFRBS13340
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52276-NHRBS13340
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52276-NMRBS13340
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52276-NYRBS13340
    Мышь FBXW2 Джин ORF экспрессии кДНК клона плазмидыMG52276-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52276-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.