After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FBXO8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015791.3
Размер кДНК:960bp
Описание кДНК:Full length Clone DNA of Mus musculus F-box protein 8 with C terminal His tag.
Синоним гена:Fbx8
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52292-ACGRBS15400
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52292-ACRRBS15400
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52292-ANGRBS15400
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52292-ANRRBS15400
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52292-CFRBS13340
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52292-CHRBS13340
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52292-CMRBS13340
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52292-CYRBS13340
Мышь FBXO8 Джин клон кДНК в вектор клонированияMG52292-GRBS5130
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52292-NFRBS13340
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52292-NHRBS13340
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52292-NMRBS13340
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52292-NYRBS13340
Мышь FBXO8 Джин ORF экспрессии кДНК клона плазмидыMG52292-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52292-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».