After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FAM69B Информация о продукте «Клон cDNA»
Размер кДНК:1296bp
Описание кДНК:Full length Clone DNA of Mus musculus family with sequence similarity 69, member B with C terminal HA tag.
Синоним гена:PIP49, AB030186, AW209000, B230317C12Rik, RP23-125H15.2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51759-ACGRBS15396
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51759-ACRRBS15396
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51759-CFRBS13343
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51759-CHRBS13343
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51759-CMRBS13343
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51759-CYRBS13343
Мышь FAM69B Джин клон кДНК в вектор клонированияMG51759-GRBS5132
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51759-NFRBS13343
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51759-NHRBS13343
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51759-NMRBS13343
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51759-NYRBS13343
Мышь FAM69B Джин ORF экспрессии кДНК клона плазмидыMG51759-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51759-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.