Быстрый заказ

Text Size:AAA

Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FAM216A Информация о продукте «Клон cDNA»
Размер кДНК:756bp
Описание кДНК:Full length Clone DNA of Mus musculus family with sequence similarity 216, member A with N terminal HA tag.
Синоним гена:1500011H22Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52029-ACGRBS15400
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52029-ACRRBS15400
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52029-ANGRBS15400
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52029-ANRRBS15400
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52029-CFRBS13340
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52029-CHRBS13340
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52029-CMRBS13340
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52029-CYRBS13340
Мышь C12orf24/FAM216A Джин клон кДНК в вектор клонированияMG52029-GRBS5130
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52029-NFRBS13340
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52029-NHRBS13340
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52029-NMRBS13340
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52029-NYRBS13340
Мышь C12orf24/FAM216A Джин ORF экспрессии кДНК клона плазмидыMG52029-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52029-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.