After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FAM19A5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_134096.2
Размер кДНК:378bp
Описание кДНК:Full length Clone DNA of Mus musculus family with sequence similarity 19, member A5 with N terminal HA tag.
Синоним гена:TAFA5, Tafa-5, Tara-5, AW049604, Fam19a5
Виды:Mouse
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50556-ACGRBS15396
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50556-ACRRBS15396
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50556-CFRBS13343
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50556-CHRBS13343
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50556-CMRBS13343
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50556-CYRBS13343
Мышь FAM19A5 Джин клон кДНК в вектор клонированияMG50556-MRBS5132
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50556-NFRBS13343
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50556-NHRBS13343
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50556-NMRBS13343
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50556-NYRBS13343
Мышь FAM19A5 Джин ORF экспрессии кДНК клона плазмидыMG50556-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50556-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».