After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FAM19A4 Информация о продукте «Клон cDNA»
Размер кДНК:408bp
Описание кДНК:Full length Clone DNA of Mus musculus family with sequence similarity 19, member A4 with N terminal HA tag.
Синоним гена:Tafa-4, MGC107151, C130034I18Rik, Fam19a4Tafa-4, Fam19a4
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50555-ACGRBS15400
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50555-ACRRBS15400
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50555-CFRBS13340
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50555-CHRBS13340
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50555-CMRBS13340
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50555-CYRBS13340
Мышь FAM19A4 / TAFA4 Джин клон кДНК в вектор клонированияMG50555-MRBS5130
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50555-NFRBS13340
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50555-NHRBS13340
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50555-NMRBS13340
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50555-NYRBS13340
Мышь FAM19A4 / TAFA4 Джин ORF экспрессии кДНК клона плазмидыMG50555-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50555-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.