After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FAM19A2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_182807.2
Размер кДНК:408bp
Описание кДНК:Full length Clone DNA of Mus musculus family with sequence similarity 19, member A2 with N terminal HA tag.
Синоним гена:TAFA2, Tafa-2, AI851790, 6330575M02, FAM19A2TAFA-2, Fam19a2
Виды:Mouse
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50554-ACGRBS15400
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50554-ACRRBS15400
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50554-ANGRBS15400
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50554-ANRRBS15400
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50554-CFRBS13340
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50554-CHRBS13340
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50554-CMRBS13340
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50554-CYRBS13340
Мышь FAM19A2 Джин клон кДНК в вектор клонированияMG50554-MRBS5130
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50554-NFRBS13340
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50554-NHRBS13340
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50554-NMRBS13340
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50554-NYRBS13340
Мышь FAM19A2 Джин ORF экспрессии кДНК клона плазмидыMG50554-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

FAM19A2 belongs to the FAM19/TAFA family. FAM19/TAFA family members are chemokine-like proteins. The biological functions of TAFA family members remain to be determined, but there are a few tentative hypotheses. First, TAFAs may modulate immune responses in the CNS by functioning as brain specific chemokines, and may act with other chemokines to optimize the recruitment and activity of immune cells in the CNS. Second, TAFAs may represent a novel class of neurokines that act as regulators of immune nervous cells. And third, TAFAs may control axonal sprouting following brain injury. Human FAM19A2 is 97% aa identical to mouse FAM19A2 and is expressed in the central nervous system (CNS), colon, heart, lung, spleen, kidney, and thymus, however its expression in the CNS is 50 to 1000 fold higher than in other tissues. FAM19A2 gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins.

Ссылки
  • Parsa A, et al. (2011) Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. Clin Transl Sci. 4(1):17-23.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Trynka G, et al. (2009) Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. Gut. 58(8):1078-83.
  • Size / Price
    Каталог: MG50554-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».