After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FAM19A1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_182808.2
Размер кДНК:402bp
Описание кДНК:Full length Clone DNA of Mus musculus family with sequence similarity 19, member A1.
Синоним гена:TAFA1, Tafa-1, C630007B19Rik, FAM19A1TAFA-1, Fam19a1
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50264-ACGRBS15400
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50264-ACRRBS15400
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50264-CFRBS13340
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50264-CHRBS13340
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50264-CMRBS13340
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50264-CYRBS13340
Мышь FAM19A1 Джин клон кДНК в вектор клонированияMG50264-MRBS5130
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50264-NFRBS13340
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50264-NHRBS13340
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50264-NMRBS13340
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50264-NYRBS13340
Мышь FAM19A1 Джин ORF экспрессии кДНК клона плазмидыMG50264-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50264-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».