After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FAM195B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001033231.2
Размер кДНК:294bp
Описание кДНК:Full length Clone DNA of Mus musculus family with sequence similarity 195, member B.
Синоним гена:Fam195b
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52453-ACGRBS15400
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52453-ACRRBS15400
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52453-ANGRBS15400
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52453-ANRRBS15400
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52453-CFRBS13340
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52453-CHRBS13340
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52453-CMRBS13340
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52453-CYRBS13340
Мышь FAM195B Джин клон кДНК в вектор клонированияMG52453-GRBS5130
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52453-NFRBS13340
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52453-NHRBS13340
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52453-NMRBS13340
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52453-NYRBS13340
Мышь FAM195B Джин ORF экспрессии кДНК клона плазмидыMG52453-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52453-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».