FAM126B cDNA ORF Clone, Mouse, C-HA tag

Cat: MG52548-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All FAM126B Reagents

CRO Services

Product recommended


All FAM126B Reagents

FAM126B cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1761 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 126, member B with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM126B cDNA ORF Clone, Mouse, C-HA tag Alternative Names

C130065N10Rik cDNA ORF Clone, Mouse;D1Ertd53e cDNA ORF Clone, Mouse;D630010C10 cDNA ORF Clone, Mouse

FAM126B Background Information

Full Name
family with sequence similarity 126, member B

FAM126B cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
FAM126B cDNA ORF Clone in Cloning Vector, Rabbit TG65092-G
FAM126B cDNA ORF Clone, Rabbit, untagged TG65092-UT
FAM126B cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65092-ACG
FAM126B cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65092-ANG
FAM126B cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65092-ACR
FAM126B cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65092-ANR
FAM126B cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65092-CF
FAM126B cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65092-NF
FAM126B cDNA ORF Clone, Rabbit, C-His tag TG65092-CH
FAM126B cDNA ORF Clone, Rabbit, N-His tag TG65092-NH
FAM126B cDNA ORF Clone, Rabbit, C-HA tag TG65092-CY
FAM126B cDNA ORF Clone, Rabbit, N-HA tag TG65092-NY
FAM126B cDNA ORF Clone, Rabbit, C-Myc tag TG65092-CM
FAM126B cDNA ORF Clone, Rabbit, N-Myc tag TG65092-NM

FAM126B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM126B cDNA ORF Clone in Cloning Vector, Mouse MG52548-G
FAM126B cDNA ORF Clone, Mouse, untagged MG52548-UT
FAM126B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52548-ACG
FAM126B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52548-ACGLN
FAM126B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52548-ANG
FAM126B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52548-ACR
FAM126B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52548-ANR
FAM126B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52548-CF
FAM126B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52548-NF
FAM126B cDNA ORF Clone, Mouse, C-His tag MG52548-CH
FAM126B cDNA ORF Clone, Mouse, N-His tag MG52548-NH
FAM126B cDNA ORF Clone, Mouse, N-HA tag MG52548-NY
FAM126B cDNA ORF Clone, Mouse, C-Myc tag MG52548-CM
FAM126B cDNA ORF Clone, Mouse, N-Myc tag MG52548-NM
FAM126B qPCR Primer Pairs, Mouse MP202421

FAM126B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM126B cDNA ORF Clone, Human, untagged HG27665-UT
info info
添加购物车成功! 添加购物车失败!