After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse F9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007979.1
Размер кДНК:1416bp
Описание кДНК:Full length Clone DNA of Mus musculus coagulation factor IX with C terminal Myc tag.
Синоним гена:Cf9, Cf-9, AW111646, F9
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50362-ACGRBS15400
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50362-ACRRBS15400
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50362-CFRBS13340
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50362-CHRBS13340
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50362-CMRBS13340
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50362-CYRBS13340
Мышь Coagulation Factor IX / FIX / F9 Джин клон кДНК в вектор клонированияMG50362-GRBS5130
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50362-NFRBS13340
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50362-NHRBS13340
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50362-NMRBS13340
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50362-NYRBS13340
Мышь Coagulation Factor IX / FIX / F9 Джин ORF экспрессии кДНК клона плазмидыMG50362-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted protein which belongs to the peptidase S1 family. Coagulation factor IX / F9 contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one?peptidase S1 domain. Coagulation factor IX / F9 is a vitamin K-dependent plasma protein that participates in the intrinsic pathway of blood coagulation by converting factor X to its active form in the presence of Ca2+ons, phospholipids, and factor VIIIa. Defects in Coagulation factor IX / F9 are the cause of thrombophilia due to factor IX defect which is a hemostatic disorder characterized by a tendency to thrombosis. Defects in Coagulation factor IX / F9 are also the cause of recessive X-linked hemophilia B ( HEMB ) which also known as Christmas disease.

Ссылки
  • Onay U.V., et al., 2003, Br. J. Haematol. 120:656-659.
  • Vidal F., et al., 2000, Br. J. Haematol. 111:549-551.
  • Simioni P., et al., 2009, N. Engl. J. Med. 361:1671-1675.
  • Espinos C., et al., 2009, Haematologica 88:235-236.
  • Size / Price
    Каталог: MG50362-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».