After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse F3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010171.3
Размер кДНК:885bp
Описание кДНК:Full length Clone DNA of Mus musculus coagulation factor III with C terminal Flag tag.
Синоним гена:TF, Cf3, Cf-3, CD142, AA409063, F3
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50413-ACGRBS15400
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50413-ACRRBS15400
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50413-CFRBS13340
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50413-CHRBS13340
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50413-CMRBS13340
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50413-CYRBS13340
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин клон кДНК в вектор клонированияMG50413-MRBS5130
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50413-NFRBS13340
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50413-NHRBS13340
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50413-NMRBS13340
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50413-NYRBS13340
Мышь Coagulation Factor III / Tissue Factor / CD142 Джин ORF экспрессии кДНК клона плазмидыMG50413-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tissue factor (TF), also known as coagulation factor III, F3, and CD142, is a single-pass type I membrane protein which belongs to the tissue factor family. Tissue factor is one of the proteins that participate in hemostatic and inflammatory processes. Activated monocytes present in the liver increase expression of tissue factor, and while accumulating in the organ they can intensify inflammation. Tissue factor is the protein that activates the blood clotting system by binding to, and activating, the plasma serine protease, factor VIIa, following vascular injury. Tissue factor is not only the main physiological initiator of normal blood coagulation, but is also important in the natural history of solid malignancies in that it potentiates metastasis and angiogenesis and mediates outside-in signalling. Tissue factor is expressed constitutively by many tissues which are not in contact with blood and by other cells upon injury or activation; the latter include endothelial cells, tissue macrophages, and peripheral blood monocytes. Coagulation Factor III is a transmembrane glycoprotein that localizes the coagulation serine protease factor VII/VIIa (FVII/VIIa) to the cell surface. The primary function of TF is to activate the clotting cascade. The TF:FVIIa complex also activates cells by cleavage of a G-protein coupled receptor called protease-activated receptor 2 (PAR2). TF is expressed by tumor cells and contributes to a variety of pathologic processes, such as thrombosis, metastasis, tumor growth, and tumor angiogenesis. As a key regulator of haemostasis and angiogenesis, it is also involved in the pathology of several diseases, including cardiovascular, inflammatory and neoplastic conditions.

Ссылки
  • Morrissey JH. (2004) Tissue factor: a key molecule in hemostatic and nonhemostatic systems. Int J Hematol. 79(2): 103-8.
  • Milsom C, et al. (2008) Tissue factor and cancer. Pathophysiol Haemost Thromb. 36(3-4): 160-76.
  • Kasthuri RS, et al. (2009) Role of tissue factor in cancer. J Clin Oncol. 27(29): 4834-8.
  • Size / Price
    Каталог: MG50413-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».