After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse F11R Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_172647.2
Размер кДНК:903bp
Описание кДНК:Full length Clone DNA of Mus musculus F11 receptor with N terminal Flag tag.
Синоним гена:JAM, Jcam, JAM-1, JAM-A, Jcam1, Ly106, ESTM33, AA638916, 9130004G24, F11r
Виды:Mouse
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50463-ACGRBS15400
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50463-ACRRBS15400
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50463-CFRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50463-CHRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50463-CMRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50463-CYRBS13340
Мышь Junctional Adhesion Molecule A Джин клон кДНК в вектор клонированияMG50463-MRBS5130
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50463-NFRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50463-NHRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50463-NMRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50463-NYRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмидыMG50463-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

Ссылки
  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Каталог: MG50463-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».