Быстрый заказ

Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse F11R Информация о продукте «Клон cDNA»
Размер кДНК:903bp
Описание кДНК:Full length Clone DNA of Mus musculus F11 receptor with C terminal His tag.
Синоним гена:JAM, Jcam, JAM-1, JAM-A, Jcam1, Ly106, ESTM33, AA638916, 9130004G24, F11r
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50463-ACGRBS15400
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50463-ACRRBS15400
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50463-CFRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50463-CHRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50463-CMRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50463-CYRBS13340
Мышь Junctional Adhesion Molecule A Джин клон кДНК в вектор клонированияMG50463-MRBS5130
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50463-NFRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50463-NHRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50463-NMRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50463-NYRBS13340
Мышь Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмидыMG50463-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Каталог: MG50463-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.