After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse F10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007979.1
Размер кДНК:1446bp
Описание кДНК:Full length Clone DNA of Mus musculus coagulation factor X with C terminal Myc tag.
Синоним гена:fX, Cf10, F10
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50363-ACGRBS15400
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50363-ACRRBS15400
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50363-CFRBS13340
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50363-CHRBS13340
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50363-CMRBS13340
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50363-CYRBS13340
Мышь Coagulation Factor X/F10 Джин клон кДНК в вектор клонированияMG50363-MRBS5130
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50363-NFRBS13340
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50363-NHRBS13340
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50363-NMRBS13340
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50363-NYRBS13340
Мышь Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмидыMG50363-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

Ссылки
  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • Size / Price
    Каталог: MG50363-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».