Быстрый заказ

Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь ESD Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_016903.5
    Размер кДНК:849bp
    Описание кДНК:Full length Clone DNA of Mus musculus esterase D/formylglutathione hydrolase with C terminal Myc tag.
    Синоним гена:FGH, Es10, Es-10, sid478
    Виды:Mouse
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52754-ACGRBS15400
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52754-ACRRBS15400
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52754-ANGRBS15400
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52754-ANRRBS15400
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52754-CFRBS13340
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52754-CHRBS13340
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52754-CMRBS13340
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52754-CYRBS13340
    Мышь Esterase D/ESD Джин клон кДНК в вектор клонированияMG52754-GRBS5130
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52754-NFRBS13340
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52754-NHRBS13340
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52754-NMRBS13340
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52754-NYRBS13340
    Мышь Esterase D/ESD Джин ORF экспрессии кДНК клона плазмидыMG52754-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.

    Ссылки
  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
  • Size / Price
    Каталог: MG52754-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».