Быстрый заказ

Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ERRFI1 Информация о продукте «Клон cDNA»
Размер кДНК:1386 bp
Описание кДНК:Full length Clone DNA of Mus musculus ERBB receptor feedback inhibitor 1
Синоним гена:1300002F13Rik,AI788755,Mig-6,Mig6,RALT
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51731-ACGRBS15400
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51731-ACRRBS15400
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51731-ANGRBS15400
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51731-ANRRBS15400
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51731-CFRBS5130
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51731-CHRBS13340
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51731-CMRBS13340
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51731-CYRBS13340
Mouse ERRFI1 Gene cDNA clone plasmidMG51731-GRBS5130
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51731-NFRBS13340
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51731-NHRBS13340
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51731-NMRBS13340
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51731-NYRBS13340
Мышь ERRFI1 Джин клон кДНК в вектор клонированияMG51731-URBS5130
Мышь ERRFI1 Джин ORF экспрессии кДНК клона плазмидыMG51731-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51731-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.