Быстрый заказ

Text Size:AAA

Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MAPK1 Информация о продукте «Клон cDNA»
Размер кДНК:1074bp
Описание кДНК:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 1 with C terminal His tag.
Синоним гена:ERK, Erk2, MAPK2, PRKM2, Prkm1, C78273, p41mapk, p42mapk, AA407128, AU018647, 9030612K14Rik, Mapk1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50445-ACGRBS15400
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50445-ACRRBS15400
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50445-ANGRBS15400
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50445-ANRRBS15400
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50445-CFRBS13340
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50445-CHRBS13340
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50445-CMRBS13340
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50445-CYRBS13340
Мышь ERK2/MAPK1/MAPK2 Джин клон кДНК в вектор клонированияMG50445-GRBS5130
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50445-NFRBS13340
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50445-NHRBS13340
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50445-NMRBS13340
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50445-NYRBS13340
Мышь ERK2/MAPK1/MAPK2 Джин ORF экспрессии кДНК клона плазмидыMG50445-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. ERK is a versatile protein kinase that regulates many cellular functions. Growing evidence suggests that extracellular signal-regulated protein kinase 1/2 (ERK1/2) plays a crucial role in promoting cell death in a variety of neuronal systems, including neurodegenerative diseases. It is believed that the magnitude and the duration of ERK1/2 activity determine its cellular function. Activation of ERK1/2 are implicated in the pathophysiology of spinal cord injury (SCI). ERK2 signaling is a novel target associated with the deleterious consequences of spinal injury. ERK-2, also known as Mitogen-activated protein kinase 1 (MAPK1), is a member of the protein kinase superfamily and MAP kinase subfamily. MKP-3 is a dual specificity phosphatase exclusively specific to MAPK1 for its substrate recognition and dephosphorylating activity. The activation of MAPK1 requires its phosphorylation by upstream kinases. Upon activation, MAPK1 translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. MAPK1 is involved in both the initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors such as ELK1. MAPK1 acts as a transcriptional repressor which represses the expression of interferon gamma-induced genes. Transcriptional activity is independent of kinase activity. The nuclear-cytoplasmic distribution of ERK2 is regulated in response to various stimuli and changes in cell context. Furthermore, the nuclear flux of ERK2 occurs by several energy- and carrier-dependent and -independent mechanisms. ERK2 has been shown to translocate into and out of the nucleus by facilitated diffusion through the nuclear pore, interacting directly with proteins within the nuclear pore complex, as well as by karyopherin-mediated transport. ERK2 interacts with the PDE4 catalytic unit by binding to a KIM (kinase interaction motif) docking site located on an exposed beta-hairpin loop and an FQF (Phe-Gln-Phe) specificity site located on an exposed alpha-helix. These flank a site that allows phosphorylation by ERK, the functional outcome of which is orchestrated by the N-terminal UCR1/2 (upstream conserved region 1 and 2) modules.

  • Houslay MD, et al. (2003) The role of ERK2 docking and phosphorylation of PDE4 cAMP phosphodiesterase isoforms in mediating cross-talk between the cAMP and ERK signalling pathways. Biochem Soc Trans. 31(Pt 6): 1186-90.
  • Jivan A, et al. (2010) Reconstitution of the Nuclear Transport of the MAP Kinase ERK2. Methods Mol Biol. 661: 273-85.
  • Yu CG, et al. (2010) Involvement of ERK2 in traumatic spinal cord injury. J Neurochem. 113(1): 131-42.
  • Subramaniam S, et al. (2010) ERK and cell death: ERK1/2 in neuronal death. FEBS J. 277(1): 22-9.
  • Size / Price
    Каталог: MG50445-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.