ERGIC1 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52018-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ERGIC1 Reagents

CRO Services

Product recommended


All ERGIC1 Reagents

ERGIC1 cDNA ORF Clone, Mouse, C-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
873 bp
Description
Full length Clone DNA of Mouse endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ERGIC1 cDNA ORF Clone, Mouse, C-His tag Alternative Names

1200007D18Rik cDNA ORF Clone, Mouse;maa-136 cDNA ORF Clone, Mouse

ERGIC1 Background Information

Full Name
endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1

ERGIC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ERGIC1 cDNA ORF Clone in Cloning Vector, Mouse MG52018-U
ERGIC1 cDNA ORF Clone, Mouse, untagged MG52018-UT
ERGIC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52018-ACGLN
ERGIC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52018-ACG
ERGIC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52018-ANG
ERGIC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52018-ACR
ERGIC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52018-ANR
ERGIC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52018-CF
ERGIC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52018-NF
ERGIC1 cDNA ORF Clone, Mouse, N-His tag MG52018-NH
ERGIC1 cDNA ORF Clone, Mouse, C-HA tag MG52018-CY
ERGIC1 cDNA ORF Clone, Mouse, N-HA tag MG52018-NY
ERGIC1 cDNA ORF Clone, Mouse, C-Myc tag MG52018-CM
ERGIC1 cDNA ORF Clone, Mouse, N-Myc tag MG52018-NM
ERGIC1 qPCR Primer Pairs, Mouse MP201891

ERGIC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ERGIC1 cDNA ORF Clone in Cloning Vector, Human HG23924-U
ERGIC1 cDNA ORF Clone, Human, untagged HG23924-UT
ERGIC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG23924-ACG
ERGIC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23924-ACGLN
ERGIC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG23924-ANG
ERGIC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG23924-ACR
ERGIC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG23924-ANR
ERGIC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23924-CF
ERGIC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23924-NF
ERGIC1 cDNA ORF Clone, Human, C-His tag HG23924-CH
ERGIC1 cDNA ORF Clone, Human, N-His tag HG23924-NH
ERGIC1 cDNA ORF Clone, Human, C-HA tag HG23924-CY
ERGIC1 cDNA ORF Clone, Human, N-HA tag HG23924-NY
ERGIC1 cDNA ORF Clone, Human, C-Myc tag HG23924-CM
ERGIC1 cDNA ORF Clone, Human, N-Myc tag HG23924-NM
info info
添加购物车成功! 添加购物车失败!