Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1368 bp
Description
Full length Clone DNA of Mouse epoxide hydrolase 1, microsomal with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Epoxide hydrolase/EPHX1 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

AI195553 cDNA ORF Clone, Mouse; Eph-1 cDNA ORF Clone, Mouse; Eph1 cDNA ORF Clone, Mouse; mEH cDNA ORF Clone, Mouse

Epoxide hydrolase/EPHX1 Background Information

Full Name
epoxide hydrolase 1, microsomal (xenobiotic)
Add to Cart Successfully Add to Cart Failed