Быстрый заказ

Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse EPHX1 Информация о продукте «Клон cDNA»
Размер кДНК:1368bp
Описание кДНК:Full length Clone DNA of Mus musculus epoxide hydrolase 1, microsomal with N terminal His tag.
Синоним гена:mEH, Eph1, Eph-1, AI195553
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51960-ACGRBS15400
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51960-ACRRBS15400
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51960-ANGRBS15400
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51960-ANRRBS15400
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51960-CFRBS13340
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51960-CHRBS13340
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51960-CMRBS13340
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51960-CYRBS13340
Мышь Epoxide hydrolase/EPHX1 Джин клон кДНК в вектор клонированияMG51960-GRBS5130
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51960-NFRBS13340
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51960-NHRBS13340
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51960-NMRBS13340
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51960-NYRBS13340
Мышь Epoxide hydrolase/EPHX1 Джин ORF экспрессии кДНК клона плазмидыMG51960-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51960-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.