EphB4 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

EphB4 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2964 bp
Description
Full length Clone DNA of Mouse Eph receptor B4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EphB4 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

AI042935 cDNA ORF Clone, Mouse; Htk cDNA ORF Clone, Mouse; MDK2 cDNA ORF Clone, Mouse; Myk1 cDNA ORF Clone, Mouse; Tyro11 cDNA ORF Clone, Mouse

EphB4 Background Information

Ephrin type-B receptor 4 is a protein that in humans is encoded by the EPHB4 gene. It is a single-pass type I membrane protein belonging to the ephrin receptor subfamily of protein kinase superfamily. Members of the ephrin and Eph family are local mediators of cell function through largely contact-dependent processes in development and in maturity. Furthermore, EphB4 protein and the corresponding ligand Ephrin-B2 contribute to tumor growth in various human tumors. EphB4 protein has tumor suppressor activities and that regulation of cell proliferation, extracellular matrix remodeling, and invasive potential are important mechanisms of tumor suppression. Therefore, Ephrin-B2/EphB4 may be recognized as a novel prognostic indicator for cancers.
Full Name
EPH receptor B4
References
  • Davalos V, et al. (2006) EPHB4 and survival of colorectal cancer patients. Cancer Res. 66(18): 8943-8.
  • Zhao C, et al. (2006) Bidirectional ephrinB2-EphB4 signaling controls bone homeostasis. Cell Metab. 4(2): 111-21.
  • Kertesz N, et al. (2006) The soluble extracellular domain of EphB4 (sEphB4) antagonizes EphB4-EphrinB2 interaction, modulates angiogenesis, and inhibits tumor growth. Blood. 107(6): 2330-8.
  • Noren NK, et al. (2007) Paradoxes of the EphB4 receptor in cancer. Cancer Res. 67(9): 3994-7.
  • Taylor AC, et al. (2007) EphB4 expression along adult rat microvascular networks: EphB4 is more than a venous specific marker. Microcirculation. 14(3): 253-67.
Add to Cart Successfully Add to Cart Failed