After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ENTPD5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001026214.1
Размер кДНК:1284bp
Описание кДНК:Full length Clone DNA of Mus musculus ectonucleoside triphosphate diphosphohydrolase 5 with C terminal His tag.
Синоним гена:Pcph, Cd39l4, mNTPase, AI196558, AI987697, NTPDase5, ER-UDPase, NTPDase-5, Entpd5
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50473-ACGRBS15400
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50473-ACRRBS15400
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50473-ANGRBS15400
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50473-ANRRBS15400
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50473-CFRBS13340
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50473-CHRBS13340
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50473-CMRBS13340
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50473-CYRBS13340
Мышь ENTPD5 Джин клон кДНК в вектор клонированияMG50473-MRBS5130
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50473-NFRBS13340
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50473-NHRBS13340
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50473-NMRBS13340
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50473-NYRBS13340
Мышь ENTPD5 Джин ORF экспрессии кДНК клона плазмидыMG50473-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5), also known as CD39 antigen-like 4, ER-UDPase, Guanosine-diphosphatase ENTPD5, Nucleoside diphosphatase Uridine-diphosphatase ENTPD5. This hydrolase is expressed in response to phosphoinositide 3-kinase (PI3K) signaling. Activation of PI3K results in FOXO phosphorylation by AKT1 and loss of ENTPD5 transcriptional repression. It is Up-regulated in PTEN-deficient cells. Uridine diphosphatase (UDPase) that promotes protein N-glycosylation and ATP level regulation.ENTPD5 promotes protein N-glycosylation and folding in the endoplasmic reticulum, as well as elevated ATP consumption in the cytosol via an ATP hydrolysis cycle. Together with CMPK1 and AK1, ENTPD5 constitutes an ATP hydrolysis cycle that converts ATP to AMP and results in a compensatory increase in aerobic glycolysis. ENTPD5 also hydrolyzes GDP and IDP but not any other nucleoside di-, mono- or triphosphates, nor thiamine pyrophosphate. This enzyme Plays a key role in the AKT1-PTEN signaling pathway by promoting glycolysis in proliferating cells in response to phosphoinositide 3-kinase (PI3K) signaling.

Ссылки
  • Villar J, et al. (2009) PCPH/ENTPD5 expression confers to prostate cancer cells resistance against cisplatin-induced apoptosis through protein kinase Calpha-mediated Bcl-2 stabilization. Cancer Res. 69(1): 102-10.
  • Fang M, et al. (2010) The ER UDPase ENTPD5 promotes protein N-glycosylation, the Warburg effect, and proliferation in the PTEN pathway. Cell. 143(5): 711-24.
  • Paez JG, et al. (2001) Identity between the PCPH proto-oncogene and the CD39L4 (ENTPD5) ectonucleoside triphosphate diphosphohydrolase gene. Int J Oncol. 19(6): 1249-54.
  • Size / Price
    Каталог: MG50473-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».