ENTPD3 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

ENTPD3 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1590 bp
Description
Full length Clone DNA of Mouse ectonucleoside triphosphate diphosphohydrolase 3.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ENTPD3 cDNA ORF Clone, Mouse, untagged: Alternative Names

Cd39l3 cDNA ORF Clone, Mouse; HB6 cDNA ORF Clone, Mouse; NTPDase-3 cDNA ORF Clone, Mouse

ENTPD3 Background Information

Full Name
ectonucleoside triphosphate diphosphohydrolase 3
References
  • Fausther M, et al. (2010) Cystic fibrosis remodels the regulation of purinergic signaling by NTPDase1 (CD39) and NTPDase3. Am J Physiol Lung Cell Mol Physiol. 298(6): 804-18.
  • Vlajkovic SM, et al. (2006) Noise-induced up-regulation of NTPDase3 expression in the rat cochlea: Implications for auditory transmission and cochlear protection. Brain Res. 1104(1): 55-63.
  • Ivanenkov w, et al. (2005) Characterization of disulfide bonds in human nucleoside triphosphate diphosphohydrolase 3 (NTPDase3): implications for NTPDase structural modeling. Biochemistry. 44 (25): 8998-9012.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait