CD39 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

CD39 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1533 bp
Description
Full length Clone DNA of Mouse ectonucleoside triphosphate diphosphohydrolase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD39 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

2610206B08Rik cDNA ORF Clone, Mouse; AA408691 cDNA ORF Clone, Mouse; Cd39 cDNA ORF Clone, Mouse; NTPDase-1 cDNA ORF Clone, Mouse

CD39 Background Information

CD39, also known as ENTPD1, belongs to the GDA1/CD39 NTPase family. It is expressed primarily on activated lymphoid cells and can also be detected in endothelial tissues. The vascular isoform and the placental isoform II are present in both placenta and umbilical vein, whereas placental isoform I is present in placenta only. CD39 can hydrolyze both nucleoside triphosphates and diphosphates. It is the dominant ecto nucleotidase of vascular and placental trophoblastic tissues and appears to modulate the functional expression of type 2 purinergic (P2) G protein coupled receptors (GPCRs). CD39 transgenic mice exhibit impaired platelet aggregation, prolonged bleeding times, and resistance to systemic thromboembolism. There is a correlation between ATP hydrolysis and triglycerides in patients with chronic heart disease, suggesting a relationship between ATP diphosphohydrolase and thrombogenesis. In the nervous system, CD39 could hydrolyze ATP and other nucleotides to regulate purinergic neurotransmission.
Full Name
ectonucleoside triphosphate diphosphohydrolase 1
References
  • Kunzli BM, et al. (2011) Variable impact of CD39 in experimental murine colitis. Dig Dis Sci. 2011 56 (5): 1393-403.
  • Clayton A, et al. (2011) Cancer exosomes express CD39 and CD73, which suppress T cells through adenosine production. J Immunol. 187 (2): 676-83.
  • Loza MJ, et al. (2011) T-cell specific defect in expression of the NTPDase CD39 as a biomarker for lupus. Cell Immunol. 271 (1): 110-7.
Add to Cart Successfully Add to Cart Failed