Быстрый заказ

Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

  • Mouse ENG transcript variant 3 natural ORF mammalian expression plasmid, C-Flag tag
  • Human SH2D1B ORF mammalian expression plasmid, C-Flag tag
ПаспортОбзорыСвязанные продуктыПротоколы
Мышь ENG Информация о продукте «Клон cDNA»
Размер кДНК:1959bp
Описание кДНК:Full length Clone DNA of Mus musculus endoglin, transcript variant 3 with C terminal Flag tag.
Синоним гена:CD105, AI528660, AI662476, S-endoglin, Eng
Участок рестрикции:KpnI + XbaI (6kb + 2kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with ENG qPCR primers for gene expression analysis, MP200084 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь ENG Gene Plasmid Map
Mouse ENG transcript variant 3 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50407-ACGRBS16760
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50407-ACRRBS16760
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50407-CFRBS14710
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50407-CHRBS14710
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50407-CMRBS14710
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50407-CYRBS14710
Мышь Endoglin/CD105 transcript variant 3 Джин клон кДНК в вектор клонированияMG50407-MRBS5130
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50407-NFRBS14710
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50407-NHRBS14710
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50407-NMRBS14710
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50407-NYRBS14710
Мышь Endoglin/CD105 transcript variant 3 Джин ORF экспрессии кДНК клона плазмидыMG50407-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.