After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ELANE Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015779.2
Размер кДНК:798bp
Описание кДНК:Full length Clone DNA of Mus musculus elastase, neutrophil expressed with N terminal Myc tag.
Синоним гена:NE, F430011M15Rik, Ela2
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50204-ACGRBS15400
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50204-ACRRBS15400
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50204-ANGRBS15400
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50204-ANRRBS15400
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50204-CFRBS13340
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50204-CHRBS13340
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50204-CMRBS13340
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50204-CYRBS13340
Мышь ELA2/Neutrophil Elastase Джин клон кДНК в вектор клонированияMG50204-MRBS5130
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50204-NFRBS13340
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50204-NHRBS13340
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50204-NMRBS13340
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50204-NYRBS13340
Мышь ELA2/Neutrophil Elastase Джин ORF экспрессии кДНК клона плазмидыMG50204-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mouse Neutrophil elastase, also known as Elastase-2, Bone marrow serine protease, Medullasin, ELANE, and ELA2, is a serine proteinase in the same family as chymotrypsin and has broad substrate specificity. Secreted by neutrophils during inflammation, it destroys bacteria and host tissue. As with other serine proteinases, ELANE / ELA2 contains a charge relay system composed of the catalytic triad of histidine, aspartate, and serine residues that are dispersed throughout the primary sequence of the polypeptide but that are brought together in the three dimension conformation of the folded protein. ELANE / ELA2 is an important protease enzyme that when expressed aberrantly can cause emphysema or emphysematous changes. This involves breakdown of the lung structure and increased airspaces. Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. ELANE / ELA2 hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix following the protein's release from activated neutrophils. ELANE / ELA2 may play a role in degenerative and inflammatory diseases by its proteolysis of collagen-IV and elastin of the extracellular matrix. ELANE / ELA2 degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Defects in ELANE are a cause of cyclic haematopoiesis (CH), also known as cyclic neutropenia. CH is an autosomal dominant disease in which blood-cell production from the bone marrow oscillates with 21-day periodicity. Defects in ELANE are also the cause of autosomal dominant severe congenital neutropenia type 1 (SCN1) which is a heterogeneous disorder of hematopoiesis.

Size / Price
Каталог: MG50204-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».