Быстрый заказ

Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь EIF4EBP1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_007918.3
    Размер кДНК:354bp
    Описание кДНК:Full length Clone DNA of Mus musculus Eukaryotic translation initiation factor 4E-binding protein 1 with N terminal His tag.
    Синоним гена:4e-bp1, PHAS-I
    Виды:Mouse
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EIF4EBP1 qPCR primers for gene expression analysis, MP200714 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50739-ACGRBS15400
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50739-ACRRBS15400
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50739-ANGRBS15400
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50739-ANRRBS15400
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50739-CFRBS13340
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50739-CHRBS13340
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50739-CMRBS13340
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50739-CYRBS13340
    Мышь 4E-BP1/EIF4EBP1 Джин клон кДНК в вектор клонированияMG50739-GRBS5130
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50739-NFRBS13340
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50739-NHRBS13340
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50739-NMRBS13340
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50739-NYRBS13340
    Мышь 4E-BP1/EIF4EBP1 Джин ORF экспрессии кДНК клона плазмидыMG50739-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    The translational suppressor eIF4E binding protein-1, 4E-BP1 functions as a key regulator in cellular growth, differentiation, apoptosis and survival. The Eif4ebp1 gene, encoding 4E-BP1, is a direct target of a transcription factor activating transcription factor-4 (ATF4), a master regulator of gene expression in stress responses. 4E-BP1 is characterized by its capacity to bind specifically to eIF4E and inhibit its interaction with eIF4G. Phosphorylation of 4E-BP1 regulates eIF4E availability, and therefore, cap-dependent translation, in cell stress. Binding of eIF4E to eIF4G is inhibited in a competitive manner by 4E-BP1. Phosphorylation of 4E-BP1 decreases the affinity of this protein for eIF4E, thus favouring the binding of eIF4G and enhancing translation. 4E-BP1 is important for beta-cell survival under endoplasmic reticulum (ER) stress. 4E-BP1 mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways. Recently, 4E-BP1 was found to be a key factor, which converges several oncogenic signals, phosphorylates the molecules, and drives the downstream proliferative signals. Recent studies showed that high expression of phosphorylated 4E-BP-1 (p-4E-BP1) is associated with poor prognosis, tumor progression, or nodal metastasis in different human cancers.

    Ссылки
  • Azar R, et al. (2008) Phosphatidylinositol 3-kinase-dependent transcriptional silencing of the translational repressor 4E-BP1. Cell Mol Life Sci. 65(19): 3110-7.
  • Tominaga R, et al. (2010) The JNK pathway modulates expression and phosphorylation of 4E-BP1 in MIN6 pancreatic beta-cells under oxidative stress conditions. Cell Biochem Funct. 28(5): 387-93.
  • Ayuso MI, et al. (2010) New hierarchical phosphorylation pathway of the translational repressor eIF4E-binding protein 1 (4E-BP1) in ischemia-reperfusion stress. J Biol Chem. 285(45): 34355-63.
  • Size / Price
    Каталог: MG50739-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».