Быстрый заказ

Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse EGFL7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_178444.3
Размер кДНК:825bp
Описание кДНК:Full length Clone DNA of Mus musculus EGF-like domain 7 with C terminal His tag.
Синоним гена:Zneu1, VE-statin, Egfl7
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50472-ACGRBS15400
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50472-ACRRBS15400
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50472-CFRBS13340
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50472-CHRBS13340
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50472-CMRBS13340
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50472-CYRBS13340
Мышь VE-statin/EGFL7 Джин клон кДНК в вектор клонированияMG50472-MRBS5130
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50472-NFRBS13340
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50472-NHRBS13340
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50472-NMRBS13340
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50472-NYRBS13340
Мышь VE-statin/EGFL7 Джин ORF экспрессии кДНК клона плазмидыMG50472-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Epidermal growth factor-like protein 7, also known as EGF-like protein 7, Multiple epidermal growth factor-like domains protein 7, Multiple EGF-like domains protein 7, Vascular endothelial statin, NOTCH4-like protein and EGFL7, is a secreted protein which contains two EGF-like domains and one EMI domain. EGFL7 was identified by a number of groups as a putative secreted factor produced by the vascular endothelial cells (ECs). EGFL7 is described as a novel endothelial cell-derived factor involved in the regulation of the spatial arrangement of cells during vascular tube assembly. With its impact on tubulogenesis and vessel shape EGFL7 joined the large family of molecules governing blood vessel formation. EGFL7 regulates midline angioblast migration in zebrafish embryos-a key step in vascular tubulogenesis. EGFL7 is tightly associated with the extracellular matrix (ECM), and it supports EC migration either as a single factor or in combination with other ECM molecules. EGFL7 provides a proper microenvironment for endothelial cell migration, thereby enabling accurate patterning. Our study indicates that the molecular composition of the ECM influences vascular morphogenesis. EGFL7 also regulates vascular tubulogenesis. It inhibits platelet-derived growth factor (PDGF)-BB-induced smooth muscle cell migration and promotes endothelial cells adhesion to the substrate.

Ссылки
  • Fitch,M.J. et al., 2004, Dev Dyn. 230 (2):316-24.
  • Schmidt,M. et al., 2007, Novartis Found Symp. 283 :18-28.
  • Campagnolo,L.et al., 2008, Gene Expr Patterns  8 (6):389-96.
  • Picuric,S. et al., 2009, Protein Expr Purif. 68 (1):1-6.
  • Nikolic,I. et al., 2010, J Angiogenes Res. 2 (1): 9. 
  • Size / Price
    Каталог: MG50472-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».