Быстрый заказ

Text Size:AAA

Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse EFHD2 Информация о продукте «Клон cDNA»
Размер кДНК:723bp
Описание кДНК:Full length Clone DNA of Mus musculus EF hand domain containing 2 with C terminal His tag.
Синоним гена:AA408606, D4Wsu27e, 2600015J22Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52277-ACGRBS15400
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52277-ACRRBS15400
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52277-ANGRBS15400
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52277-ANRRBS15400
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52277-CFRBS13340
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52277-CHRBS13340
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52277-CMRBS13340
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52277-CYRBS13340
Мышь EFHD2 Джин клон кДНК в вектор клонированияMG52277-GRBS5130
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52277-NFRBS13340
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52277-NHRBS13340
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52277-NMRBS13340
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52277-NYRBS13340
Мышь EFHD2 Джин ORF экспрессии кДНК клона плазмидыMG52277-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52277-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.