After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse EEF2 Информация о продукте «Клон cDNA»
Размер кДНК:2577bp
Описание кДНК:Full length Clone DNA of Mus musculus eukaryotic translation elongation factor 2 with C terminal HA tag.
Синоним гена:Ef-2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51203-ACGRBS22240
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51203-ACRRBS22240
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51203-ANGRBS22240
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51203-ANRRBS22240
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51203-CFRBS20190
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51203-CHRBS20190
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51203-CMRBS20190
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51203-CYRBS20190
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51203-NFRBS20190
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51203-NHRBS20190
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51203-NMRBS20190
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51203-NYRBS20190
Мышь EEF2 Джин клон кДНК в вектор клонированияMG51203-URBS5130
Мышь EEF2 Джин ORF экспрессии кДНК клона плазмидыMG51203-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51203-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.