ECM1 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

ECM1 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1680 bp
Description
Full length Clone DNA of Mouse extracellular matrix protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ECM1 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

AI663821 cDNA ORF Clone, Mouse; p85 cDNA ORF Clone, Mouse

ECM1 Background Information

Extracellular matrix protein 1 (ECM1) is a secreted glycoprotein and playing a pivotal role in endochondral bone formation, angiogenesis, and tumour biology. Three splice variants have been identified: ECM1a (54 aa) is most widely expressed, with highest expression in the placenta and heart; ECM1b (415 aa) is differentiation-dependent expressed and found only in tonsil and associated with suprabasal keratinocytes; ECM1c (559 aa) accounts for approximately 15% of skin ECM1. Although ECM1 is not tumor specific, is significantly elevated in many malignant epithelial tumors and is suggested as a possible trigger for angiogenesis, tumor progression and malignancies. It also has been shown to regulate endochondral bone formation, skeletal development and tissue remodeling.
Full Name
extracellular matrix protein 1
Research Areas
References
  • Oyama N, et al. (2003) Autoantibodies to extracellular matrix protein 1 in lichen sclerosus. Lancet. 362(9378): 118-23.
  • Chan I, et al. (2004) Rapid diagnosis of lipoid proteinosis using an anti-extracellular matrix protein 1 (ECM1) antibody. J Dermatol Sci. 35(2): 151-3.
  • Lupo I, et al. (2005) A novel mutation of the extracellular matrix protein 1 gene (ECM1) in a patient with lipoid proteinosis (Urbach-Wiethe disease) from Sicily. Br J Dermatol. 153(5): 1019-22.
  • Sander CS, et al. (2006) Expression of extracellular matrix protein 1 (ECM1) in human skin is decreased by age and increased upon ultraviolet exposure. Br J Dermatol. 154(2): 218-24.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait