Быстрый заказ

Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse DYNLRB1 Информация о продукте «Клон cDNA»
Размер кДНК:291bp
Описание кДНК:Full length Clone DNA of Mus musculus dynein light chain roadblock-type 1 with N terminal His tag.
Синоним гена:DNLC2A, Dncl2a, km23-1, AV124457, 2010012N15Rik, 2010320M17Rik, 9430076K19Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52823-ACGRBS15400
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52823-ACRRBS15400
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52823-ANGRBS15400
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52823-ANRRBS15400
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52823-CFRBS13340
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52823-CHRBS13340
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52823-CMRBS13340
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52823-CYRBS13340
Мышь DYNLRB1 Джин клон кДНК в вектор клонированияMG52823-GRBS5130
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52823-NFRBS13340
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52823-NHRBS13340
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52823-NMRBS13340
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52823-NYRBS13340
Мышь DYNLRB1 Джин ORF экспрессии кДНК клона плазмидыMG52823-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52823-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.